Expression of transcription and growth factors and the AKT/m-TOR signaling pathway components in papillary thyroid cancer

Cover Page

Abstract


Background: The molecular mechanism of thyroid cancer development is associated with changes in expression of transcription factors and growth factors accompanied by modified level of the AKT/m-TOR components.

Aims. The aim of study was to determine NF-κB p65, NF-κB p50, HIF-1α, HIF-2α, VEGF, CAIX, VEGFR2 expression and mRNA level of the AKT/m-TOR signaling pathway components in papillary thyroid cancer compared to those in benign lesions.

Material and methods: Forty patients aged 33—66 years with T1-4N0-2M0 papillary thyroid cancer (7 males and 33 females) were enrolled in the study. The mean age was 52.0±2.6 years. The comparison group included patients with benign lesions of thyroid tissue (4 males and 18 females) aged 38—66 years (mean age, 53.0±4.4 years). Expression levels of NF-κB p65, NF-κB p50, HIF-1α, HIF-2α, VEGF, CAIX, VEGFR2, and the AKT/m-TOR signaling pathway components were determined by RT-PCR using specific primers.

Results: Increased expression of transcription factors NF-κB and HIF-2α was found in papillary thyroid cancer. The levels of AKT and PTEN mRNA were elevated in transformed tissues. c-Raf expression was reduced 2.1-fold in cancer compared to that in thyroid tissues with benign lesions. Multiple positive correlations were revealed between transcription and growth factors and the AKT/m-TOR signaling pathway components in cancer. An association between PTEN expression and the NF-κB mRNA level was revealed, being a sign of deregulation in the signaling cascade in cancer tissues.

Conclusions: Overexpression of NF-κB, HIF-2α, AKT, PTEN and reduction of c-Raf expression is typical of thyroid papillary cancer.


На долю рака щитовидной железы приходится 1—1,5% всех онкологических заболеваний. Разработка новых подходов к диагностике и прогнозированию развития этого вида рака является чрезвычайно актуальным в последние десятилетия, что связано с постоянно увеличивающимися темпами прироста заболеваемости. Так, за период с 2004 по 2014 г. прирост заболеваемости населения России раком щитовидной железы составил 18,47%, что позволяет отнести этот рак к самой распространенной злокачественной опухоли эндокринных желез [1].

Развитие злокачественных новообразований щитовидной железы связано с активацией транскрипционных и ростовых факторов. Ключевыми среди них являются транскрипционный фактор NF-κB, играющий основную роль в процессах онкогенеза [2—4], а также ядерный фактор HIF, который способствует образованию ростового фактора VEGF и карбоангидразы IX, определяющих неоангиогенез. Эти события активируют AKT/m-TOR сигнальный каскад и лежат в основе роста и распространения опухоли [5].

Гиперактивация AKT/m-TOR сигнального пути — характерный признак большинства раковых клеток и, по-видимому, играет ключевую роль в механизмах опухолевой трансформации клеток и прогрессии опухолей [6]. К значимым компонентам этого пути относят протеинкиназы AKT, c-Raf, GSK-3, PDK1, а также m-TOR, ее субстраты p70-S64 и E-BP1. Активность данного сигнального каскада регулируется белком-онкосупрессором PTEN.

В опухолях эндокринных органов AKT/m-TOR сигнальный путь изучен менее чем в опухолях другой локализации [7]. Существуют множественные зависимости между уровнями молекулярных маркеров, что отражает интенсивность патологических процессов и может влиять на прогноз заболевания. Однако вклад молекулярных показателей, связанных с активацией транскрипционных, ростовых факторов и компонентов AKT/m-TOR сигнального пути, определяющих особенности папиллярного рака щитовидной железы (ПРЩЖ), практически не исследован.

Цель исследования — сравнение экспрессии транскрипционных факторов NF-κB p65 и p50, HIF-1α, HIF-2α, ростовых факторов VEGF, CAIX и VEGFR2, а также компонентов AKT/m-TOR сигнального пути в ткани ПРЩЖ и в доброкачественных опухолях щитовидной железы.

Материал и методы

Дизайн исследования

Проведено обсервационное одномоментное сплошное контролируемое исследование.

Критерии соответствия

В исследование включали пациентов с верифицированным ПРЩЖ в стадии T1-4N0-2M0 в возрасте от 30 до 70 лет при условии добровольного подписания информированного согласия. В группу контроля включали пациентов с доброкачественными образованиями щитовидной железы сопоставимого возраста при том же условии. Критериями исключения были возраст старше 70 лет, диссеминированный рак щитовидной железы, наличие тяжелой сопутствующей патологии, наличие первично-множественных опухолей других локализаций, отказ пациента от участия в протоколе.

Условия проведения

Исследование проводилось в Научно-исследовательском институте онкологии Томского национального исследовательского медицинского центра РАН.

Описание медицинского вмешательства

Объемы диагностики и лечения больных соответствовали рекомендуемым алгоритмам по диагностике и лечению злокачественных новообразований, утвержденных министерством здравоохранения РФ (2007), и клиническим рекомендациям по диагностике и лечению рака щитовидной железы (2014) [8, 9].

Пациентам с патологией щитовидной железы было проведено оперативное лечение в объеме гемитиреоидэктомии или тиреоидэктомии. На втором этапе лечения при наличии метастазов в лимфатических узлах больные получали терапию радиоактивным ­йодом. Материалом для исследования явилась опухолевая и гистологически неизмененная ткань щитовидной железы, полученная от больных обеих групп после оперативного вмешательства. Образцы тканей замораживали и хранили при –80 °С.

Основной исход исследования

Определяли экспрессию NF-κB p65 и p50, HIF-1α, HIF-2α, ростовых факторов VEGF, CAIX и VEGFR2, а также компонентов AKT/m-TOR сигнального пути в ткани ПРЩЖ и в доброкачественных опухолях щитовидной железы.

Анализ в подгруппах

В ходе исследования были сформированы две группы:

  • в группу А вошли пациенты с ПРЩЖ в стадии T1-4N0-2M0;
  • в группу Б вошли пациенты с доброкачественными новообразованиями щитовидной железы.

Методы регистрации исходов

РНК выделяли с помощью набора RNeasy mini Kit, содержащего ДНКазу I («Qiagen», Германия). На спектрофотометре NanoDrop-2000 («Thermo Scientific», США) оценивали концентрацию и чистоту выделения РНК. Концентрация РНК колебалась от 80 до 250 нг/мкл, А260/А280 = 1.95—2.05; А260/А230 = 1.90—2.31. Целостность РНК оценивалась с помощью капиллярного электрофореза на приборе TapeSta­tion («Agilent Technologies», США) и набора R6K ScreenTape («Agilent Technologies», США). RIN составил 5.6—7.8.

Уровень экспрессии генов оценивали при помощи количественной обратно-транскриптазной ПЦР в режиме реального времени (RT-qPCR) с использованием красителя SYBR Green на амплификаторе iCycler («Bio-Rad», США). Для получения кДНК на матрице РНК проводили реакцию обратной транскрипции с помощью набора m-MuLV-RH («БиоЛабмикс», Россия) со случайными гексануклеотидными праймерами в соответствии с инструкцией. ПЦР ставили в трех репликах в объеме 25 мкл, содержащем 12,5 мкл БиоМастер HS-qPCR SYBR Blue («БиоЛабмикс», Россия), 300 нM прямого и обратного праймеров и 50 нг кДНК. Двухшаговая программа амплификации включала 1 цикл — 94 °С, 10 мин — предварительная денатурация; 40 циклов — 1 шаг 94 °С, 10 с и 2 шаг 20 с — при 60 °С. Праймеры были подобраны с использованием программы Vector NTI Advance 11.5 и базы данных NCBI (http://www.ncbi.nlm. nih.gov/nuccore) (табл. 1).

 

Таблица 1. Последовательность праймеров проб исследованных генов

Ген

Ампликон

Последовательность

CAIX

NM_001216.2

217 п.н.

F 5'-GTTGCTGTCTCGCTTGGAA-3'

R 5'-CAGGGTGTCAGAGAGGGTGT-3'

HIF-1a

NM_001243084.1

188 п.н.

F 5'- CAAGAACCTACTGCTAATGCCA-3'

R 5'- TTTGGTGAGGCTGTCCGA-3'

EPAS1

NM_001430.4

265 п.н.

F 5'- TGGAGTATGAAGAGCAAGCCT-3'

R 5'-GGGAACCTGCTCTTGCTGT-3'

NFKB1

NM_00116 5'412.1

144 п.н.

F 5'-CGTGTAAACCAAAGCCCTAAA-3'

R 5'-AACCAAGAAAGGAAGCCAAGT-3'

RELA

NM_00114 5'138.1

271 п.н.

F 5'-GGAGCACAGATACCACCAAGA-3'

R 5'-GGGTTGTTGTTGGTCTGGAT-3'

PTEN

NM_001304717.2

136 п.н.

F 5'-GGGAATGGAGGGAATGCT-3'

R 5'-CGCAAACAACAAGCAGTGA-3'

VEGFA

NM_00102 5'366.2

316 п.н.

F 5'-AGGGCAGAATCATCACGAA-3'

R 5'-TCTTGCTCTATCTTTCTTTGGTCT-3'

KDR

NM_0022 5'3.2

306 п.н.

F 5'-AACACAGCAGGAATCAGTCA-3'

R 5'-GTGGTGTCTGTGTCATCGGA-3'

4EBP1

NM_00409 5'.3

244 п.н.

F 5'- CAGCCCTTTCTCCCTCACT -3'

R 5'- TTCCCAAGCACATCAACCT -3'

AKT1

NM_001014431.1

181 п.н.

F 5'- CGAGGACGCCAAGGAGA -3'

R 5'- GTCATCTTGGTCAGGTGGTGT -3'

С-RAF

NM_002880.3

152 п.н.

F 5'- TGGTGTGTCCTGCTCCCT -3'

R 5'- ACTGCCTGCTACCTTACTTCCT -3'

GSK3b

NM_0011461 5'6.1

267 п.н.

F 5'- AGACAAGGACGGCAGCAA -3'

R 5'-CTGGAGTAGAAGAAATAACGCAAT-3'

70S kinase alpha

NM_001272042.1

244 п.н.

F 5'- CAGCACAGCAAATCCTCAGA -3'

R 5'- ACACATCTCCCTCTCCACCTT -3'

m-TOR NM_0049 5'8.3

160 п.н.

F 5'- CCAAAGGCAACAAGCGAT-3'

R 5'- TTCACCAAACCGTCTCCAA -3'

PDK1 NM_001278 5'49.1

187 п.н.

F 5'- TCACCAGGACAGCCAATACA -3'

R 5'- CTCCTCGGTCACTCATCTTCA -3'

GAPDH

NM_0012 5'6799.2

138 п.н.

F 5'- GGAAGTCAGGTGGAGCGA-3'

R 5'-GCAACAATATCCACTTTACCAGA-3'

Примечание. NM — номер последовательности РНК в NCBI Nucleotide Database (http://www.ncbi.nlm.nih.gov/nuccore); F — прямой праймер; R — обратный праймер.

 

В качестве референсного гена использовали ген «домашнего хозяйства» фермента GAPDH (glyceraldehydes-3-phosphate dehydrogenase), и уровень экспрессии каждого целевого гена нормализовали по отношению к экспрессии GAPDH. Количественный анализ экспрессии проводили по 2ΔΔСt по отношению к конститутивно-экспрессируемому гену GAPDH.

Этическая экспертиза

Проведение данной работы одобрено локальным этическим комитетом НИИ онкологии Томского НИМЦ (протокол №5 от 24.04.15).

Статистический анализ

Размер выборки предварительно не рассчитывался. Статистическую обработку результатов проводили с применением пакета программ Statistica 8.0. Результаты определения экспрессии генов представлены как среднее значение ± ошибка среднего. Значимость различий оценивали с помощью критерия Манна—Уитни. Различия считали значимыми при р<0,05. Существование связи между показателями определяли с использованием корреляционного анализа, силу связи между переменными оценивали, рассчитывая коэффициент ранговой корреляции Спирмена (r).

Результаты

Участники исследования

В группу А были включены 40 больных (7 мужчин, 33 женщины) с ПРЩЖ в возрасте от 33 до 66 лет (средний возраст 52,0±2,6 года) со стадией опухолевого процесса T1-4N0-2M0. Группа Б представлена 22 больными (4 мужчины, 18 женщин) в возрасте от 38 до 66 лет (средний возраст 53,0±4,4 года) с доброкачественными новообразованиями щитовидной железы. У всех больных диагноз был морфологически верифицирован.

Основные результаты исследования

В табл. 2 представлены уровни мРНК изучаемых показателей в ткани доброкачественных новообразований и ПРЩЖ. В ткани ПРЩЖ выявлено увеличение экспрессии транскрипционных факторов NF-κB p65 и p50 в 8,7 (p=0,041) и 5,6 раза (p=0,036) соответственно, а также ядерного фактора HIF-2α в 5,3 раза (p=0,042) по сравнению с тканью доброкачественных новообразований.

 

Таблица 2. Экспрессия транскрипционных и ростовых факторов в ткани фолликулярной аденомы и папиллярного рака щитовидной железы (Х±SD)

Показатель, усл. ед.

Доброкачественные новообразования щитовидной железы (n=22)

ПРЩЖ (n=40)

NF-κB p65

0,17±0,09

1,48±0,38*

p=0,041

NF-κB p50

0,79±0,63

4,44±1,89*

p=0,036

HIF-1α

0,40±0,16

2,94±1,30

HIF-2α

0,44±0,25

2,33±0,63*

p=0,042

VEGF

0,63±0,26

3,70±1,71

VEGFR2

3,67±2,37

2,37±0,97

CAIX

5,15±4,49

2,30±0,95

Примечание. * — р<0,05 при сравнении с доброкачественными новообразованиями.

 

Экспрессия ростового фактора VEGF, его рецептора VEGFR2 и CAIX в ткани ПРЩЖ не отличалась от таковой в ткани доброкачественных опухолей железы.

На следующем этапе исследования была изучена экспрессия компонентов AKT/m-TOR сигнального пути (AKT, c-Raf, GSK-3β, PDK1 и PTEN) в ткани новообразований щитовидной железы (табл. 3). В ткани ПРЩЖ отмечено увеличение уровня мРНК протеинкиназы AKT в 8,6 раза (p=0,041) на фоне компенсаторного роста уровня мРНК PTEN в 8,1 раза (p=0,037). При этом экспрессия гена c-Raf в ткани ПРЩЖ была в 2,1 раза (p=0,048) ниже, чем в ткани доброкачественных опухолей. Однако экспрессия протеинкиназы m-TOR, ее субстратов p70-S6 киназы и 4E-BP1 не отличалась от таковой в ткани доброкачественных опухолей (см. табл. 3).

 

Таблица 3. Экспрессия AKT, c-Raf, GSK-3β, PDK1, PTEN, m-TOR и ее субстратов в ткани фолликулярной аденомы и папиллярного рака щитовидной железы (Х±SD)

Показатель, усл. ед.

Доброкачественные новообразования щитовидной железы, (n=22)

Папиллярный РЩЖ (n=40)

AKT

0,38±0,18

3,28±2,12*

p=0,041

c-Raf

3,13±2,16

1,53±0,93*

p=0,048

GSK-3β

2,95±2,19

2,87±1,98

PDK1

0,88±0,28

1,85±1,29

PTEN

0,46±0,23

3,73±1,89*

p=0,037

m-TOR

5,23±4,47

2,02±1,29

p70-S6

5,02±4,50

0,88±0,35

4E-BP1

0,65±0,29

1,62±1,12

Примечание. * — р<0,05 при сравнении с доброкачественными новообразованиями.

 

Корреляционный анализ обнаружил многочисленные связи между изучаемыми молекулярными маркерами в ткани ПРЩЖ (рис. 1). Выявлена положительная связь между экспрессией NF-κB p65, VEGFR2 (r=0,7; p<0,05), CAIX (r=0,8; p<0,05), HIF-1α (r=0,6; p<0,05) и HIF-2α (r=0,6; p<0,05); между VEGFR2 и VEGF (r=0,5; p<0,05), CAIX (r=0,6; p<0,05) и HIF-1α (r=0,7; p<0,05); а также положительная связь между экспрессией VEGF, CAIX (r=0,6; p<0,05) и HIF-2α (r=0,7; p<0,05) и прямая зависимость между экспрессией HIF-1α, CAIX (r=0,7; p<0,05) и HIF-2α (r=0,6; p<0,05). Эти взаимозависимости между транскрипционными и ростовыми факторами являются основой молекулярных механизмов развития опухоли.

 

Рис. 1. Взаимосвязи между транскрипционными и ростовыми факторами при папиллярном раке щитовидной железы. Линиями обозначены прямые связи между молекулярными маркерами.

 

В ткани ПРЩЖ обнаружена прямая зависимость между экспрессией PTEN, c-Raf (r=0,6; p<0,05) и 70-S6 (r=0,8; p<0,05), а также между m-TOR и PDK1 (r=0,7; p<0,05), что указывает на наличие системы регуляции между киназами и их ингибиторами.

Обнаружены ассоциации между экспрессией онкосупрессора PTEN c транскрипционными факторами NF-κB p65 (r=0,76; p<0,05) и NF-κB p50 (r=0,72; p<0,05) (рис. 2, 3), характеризующие особенности функционирования сигнальных каскадов. Экспрессия NF-κB p65 коррелировала также с экспрессией PDK1 (r=0,71; p<0,05), а NF-κB p50 — с c-Raf (r=0,76; p<0,05).

 

Рис. 2. График рассеяния между экспрессией PTEN и экспрессией NF-κB p65.

 

Рис. 3. График рассеяния между экспрессией PTEN и экспрессией NF-κB p50.

 

Обсуждение

Резюме основного результата исследования

Экспрессия транскрипционного фактора HIF-1 в ткани ПРЩЖ связана с прогнозом заболевания и определяет исход патологического процесса [10, 11]. В нашем исследовании показано, что к молекулярно-биологическим характеристикам данной опухоли также можно отнести повышение экспрессии HIF-2, NF-κB p65 и NF-κB p50. Эти изменения приводят к модификации экспрессии компонентов AKT/m-TOR сигнального каскада.

Обсуждение основного результата исследования

В ткани ПРЩЖ отмечено повышение экспрессии протеинкиназы AKT — одного из ключевых компонентов AKT/m-TOR сигнального каскада. Это объясняется преобладанием в клетках опухоли анаболических процессов. Имеются сведения, что в ткани рака щитовидной железы увеличивается содержание AKT [12, 13]. Иными словами, рост экспрессии гена AKT сопровождается увеличением количества его белкового продукта.

Негативным регулятором активности AKT/m-TOR сигнального пути является фосфатаза PTEN. Мы отметили рост уровня ее мРНК при ПРЩЖ. Полагают, что развитие и прогрессирование данной патологии происходят на фоне мутационных изменений гена PTEN, что является одной из причин развития раковых синдромов (синдром Cowden) и связано с формированием функционально неполноценного белка. В исследовании S. Beg и соавт. [14] показано снижение содержания PTEN в 24,5% образцов ПРЩЖ, однако при проведении флуоресцентной гибридизации in situ (FISH) дефект гена PTEN был зафиксирован только в 4,8% образцов.

Мы нашли снижение уровня мРНК c-Raf в ткани ПРЩЖ, что может быть связано с ингибирующим действием киназы AKT. В литературе [15] имеются иные данные об экспрессии протеинкиназы c-Raf в ткани ПРЩЖ. Стоит отметить, что в этой работе связь между экспрессией c-Raf и активностью AKT/m-TOR сигнального каскада не изучалась.

Известно, что ядерный фактор NF-κB может влиять на экспрессию ростового фактора VEGF как непосредственно, так и путем регуляции транскрипции ядерного фактора HIF-1α [16, 17]. Связь между экспрессией HIF-1α и HIF-2α, CAIX, VEGFR2 и между экспрессией HIF-2α и HIF-1α, VEGF также можно объяснить способностью HIF-1α и HIF-2α усиливать транскрипцию генов. Подобные сведения имеются в работах последних лет [18, 19]. Также показана совместная регуляция экспрессии VEGF, его рецептора и CAIX, что является свидетельством эффективной регуляции ангиогенеза.

В ткани ПРЩЖ выявлена связь между экспрессией m-TOR и PDK1, что указывает на роль PDK1 в активации протеинкиназы AKT, субстратом которой является m-TOR [6]. Связь экспрессии фосфатазы PTEN и p70-S6 киназы объясняется, вероятно, регуляцией активности AKT/m-TOR сигнального пути онкосупрессором PTEN [20]. Прямая зависимость между уровнем мРНК c-Raf и экспрессией PTEN показывает, что данная фосфатаза может также влиять на активность MAPK сигнального каскада, который принимает участие в регуляции пролиферации, дифференцировки и апоптоза клеток [10, 11].

Особое значение имеет обнаруженная нами положительная связь между экспрессией ядерных факторов NF-κB p65 и NF-κB p50 c PTEN. В исследованиях K. Vasudevan [21] показано, что активация транскрипционной активности данного ядерного фактора происходит в условиях супрессии PTEN и выраженной активности киназ изучаемого сигнального каскада. К ним относят c-Raf и PDK1. Потеря функциональной активности онкосупрессора PTEN приводит к усилению экспрессии NF-κB за счет активации AKT/m-TOR сигнального каскада [22]. Высокий уровень мРНК фосфатазы PTEN является косвенным доказательством измененной активности данного онкомаркера, что приводит к еще большей активности AKT.

Заключение

В настоящем исследовании установлены важные молекулярно-биологические характеристики ПРЩЖ. К ним относятся высокая экспрессия транскрипционных факторов NF-κB и HIF-2α, протеинкиназы AKT и фосфатазы PTEN, а также низкий уровень мРНК c-Raf. Особенности экспрессии транскрипционных и ростовых факторов, а также компонентов AKT/m-TOR сигнального пути могут влиять на течение заболевания, определяя эффективность лечения. Полученные данные имеют значение как для фундаментальной, так и для клинической онкологии.

Дополнительная информация

Источник финансирования. Работа проведена при поддержке ФГБУ Томский национальный медицинский центр РАН.

Конфликт интересов. Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.

Участие авторов: Л.В. Спирина — определение экспрессии изучаемых показателей, подготовка статьи к публикации; С.Ю. Чижевская — формирование групп исследования; И.В. Кондакова — координация исследования, общее руководство. Все авторы внесли существенный вклад в проведение исследования и подготовку статьи, прочли и одобрили финальную версию перед публикацией.

Liudmila V. Spirina

Tomsk National Research Medical Center of the Russian Academy of Sciences; Siberian State Medical University

Author for correspondence.
Email: spirinalv@oncology.tomsk.ru
ORCID iD: 0000-0002-5269-736X
SPIN-code: 1336-8363

Russian Federation, 5, Kooperativny Str., Tomsk, 634009; 2, Moscowski Trakt, Tomsk, 634050

MD, PhD

Sventlana Yu. Chizhevskaya

Tomsk National Research Medical Center of the Russian Academy of Sciences

Email: sch@oncology.tomsk.ru
ORCID iD: 0000-0003-2974-4778
SPIN-code: 9561-3382

Russian Federation, 5, Kooperativny Str., Tomsk, 634009

MD, PhD

Irina V. Kondakova

Tomsk National Research Medical Center of the Russian Academy of Sciences

Email: kondakova@oncology.tomsk.ru
ORCID iD: 0000-0003-0907-4615
SPIN-code: 9338-4149

Russian Federation, 5, Kooperativny Str., Tomsk, 634009

MD, PhD, Professor

  1. Злокачественные новообразования в России в 2015 г. (заболеваемость и смертность)/ Под ред. Каприна А.Д., Старинского В.В., Петровой Г.В. // М.: МНИОИ им. П.А. Герцена — Филиал ФГБУ «НМИРЦ» Минздрава России; 2017. [Kaprin AD, Starinsky VV, Petrova GV, Editors. Zlokachestvennye novoobrazovaniya v Rossii vV 2015 (zabolevaemost’ i smertnost’). Moscow: MNIOI im. P.A. Gertsena — Filial FGBU «NMIRTS» Minzdrava Rossii; 2017. (In Russ.)].
  2. Spirina LV, Usynin YA, Kondakova IV, et al. The Akt-MTOR signalling pathway in kidney cancer tissues. Aip Conf Proc. 2015; 1688:080004. doi: 10.1063/1.4936067
  3. Спирина Л.В., Усынин Е.А., Кондакова И.В., и др. Влияние таргетной терапии на содержание транскрипционных, ростовых факторов, протеинкиназы TOR и активности внутриклеточных протеиназ у больных диссеминированным раком почки. // Бюллетень экспериментальной биологии и медицины. — 2015. — Т. 60. — № 6. — C. 768—772. [Spirina LV, Usynin EA, Kondakova IV, et al. Effect of target therapy on the content of transcription and growth factors, protein kinase TOR, and activity of intracellular proteases in patients with metastatic renal cell carcinoma. Bull Eksp Biol Med. 2015;60(6):768-772. (In Russ.)].
  4. Спирина Л.В., Усынин Е.А., Юрмазов З.А., и др. Экспрессия МРНК и содержание Nf-kB, Hif-1, Hif-2, Vegf, Vegfr2 и арбоангидразы Ix при метастазировании рака почки. Молекулярная биология. — 2017. — Т. 51. — № 2. — С. 372—377. [Spirina LV, Usynin EA, YurmazovZA, et l. Transcription factors Nf-Kb, Hif-1, Hif-2, growth factor Vegf, Vegfr2 and carboanhydrase Ix MRNA and protein level in the development of kidney cancer metastasis. Molecular Biology. 2017;51(2):372-377. (In Russ.)]. doi: 10.7868/S0026898417020197
  5. Tanaka TN, Alloju SK, Oh DK, et al. Thyroid cancer: molecular pathogenesis, tyrosine kinase inhibitors, and other new therapies. Am J Hematol Oncol. 2015;11(4):5-9.
  6. Robbins HL, Hague A. The Pi3k/Akt pathway in tumors of endocrine tissues. Front Endocrinol (Lausanne). 2015;6:188. doi: 10.3389/Fendo.2015.00188
  7. Dodd KM, Yang J, Shen MH, et al. MTORC1 Drives Hif-1α and Vegf-a signalling via multiple mechanisms involving 4e-Bp1, S6k1 and Stat3. Oncogene. 2015;34(17):2239-2250. doi: 10.1038/onc.2014.164
  8. Бельцевич Д.Г., Ванушко В.Э., Мельниченко Г.А., и др. Российские клинические рекомендации по диагностике и лечению дифференцированного рака щитовидной железы у взрослых. Проект. Редакция 2016 г. // Эндокринная Хирургия. — 2015. — Т. 9. — № 3. — С. 7—17. [Bel’tsevich DG, Vanushko VE, Mel’nichenko GA, et al. Russian clinical practice guidelines for diagnosis and treatment of differentiated thyroid cancer. Endocrine Surgery. 2015;9(3):7-17. (In Russ.)]. doi: 10.14341/Serg201537-14
  9. Клинические рекомендации по диагностике и лечению рака щитовидной железы. / Под ред. Алиевой С.Б., Алымова Ю.В., Мудунова А.М., и др. — М. 2014. Доступно по http://www.Oncology.ru/Association/Clinical-Guidelines/2014/56.Pdf. Ссылка активна на 22.09.14. [Alieva SB, Alymov YuV, Mudunov AM, Editors. Clinical recommendations for the diagnosis and treatment of thyroid cancer. Ed by Podvyaznikov SO, Kropotov MA. Moscow. 2007. (In Russ)]. Dostupno po://www.Oncology.ru/Association/Clinical-Guidelines/2014/56.Pdf. Accessed 22.09.14
  10. Magnon C, Opolon P, Ricard M, et al. Radiation and inhibition of angiogenesis by canstatin synergize to induce HIFα-mediated tumor apoptotic switch. J Clin Invest. 2007;117(7):1844-1855. doi: 10.1172/jci30269
  11. Burrows N, Babur M, Resch J, et al. Hypoxia-inducible factor in thyroid carcinoma. J Thyroid Res. 2011;2011:762905. doi: 10.4061/2011/762905
  12. Vasko V. Akt activation and localisation correlate with tumour invasion and oncogene expression in thyroid cancer. J Med Genet. 2004;41(3):161-170. doi: 10.1136/jmg.2003.015339
  13. Krzeslak A, Pomorski L, Lipinska A. Expression, localization, and phosphorylation of Akt1 in benign and malignant thyroid lesions. Endocr Pathol. 2011;22(4):206-211. doi: 10.1007/s12022-011-9177-4
  14. Beg S, Siraj AK, Jehan Z, et al. PTEN loss is associated with follicular variant of middle eastern papillary thyroid carcinoma. Br J Cancer. 2015;112(12):1938-1943. doi: 10.1038/bjc.2015.169
  15. Lee J, Jeong S, Park JH, et al. Aberrant expression of cot is related to recurrence of papillary thyroid cancer. Medicine (Baltimore). 2015;94(6):E548. doi: 10.1097/Md.0000000000000548
  16. Alverdi V, Hetrick B, Joseph S, Komives EA. Direct observation of a transient ternary complex during kappabalpha-mediated dissociation of Nf-Kappab from DNA. Proc Natl Acad Sci USA. 2014;111(1):225-230. doi: 10.1073/Pnas.1318115111
  17. Potoyan DA, Zheng W, Komives EA, Wolynes PG. Molecular stripping in the Nf-Kappab/Ikappab/DNA genetic regulatory network. Proc Natl Acad Sci USA. 2016;113(1):110-115. doi: 10.1073/Pnas.1520483112
  18. Liu YM, Ying SP, Huang YR, et al. Expression of HIF-1alpha and HIF-2alpha correlates to biological and clinical significance in papillary thyroid carcinoma. World J Surg Oncol. 2016;14(1):30. doi: 10.1186/S12957-016-0785-9
  19. LV Y, Sun Y, Shi T, et al. Pigment epithelium-derived factor HAS a role in the progression of papillary thyroid carcinoma by affecting the Hif1alpha-Vegf signaling pathway. Oncol Lett. 2016;12(6):5217-5222. doi: 10.3892/Ol.2016.5316
  20. Chalhoub N, Baker SJ. PTEN and the Pi3-kinase pathway in cancer. Annu Rev Pathol. 2009;4:127-150. doi: 10.1146/Annurev.Pathol.4.110807.092311
  21. Vasudevan KM, Gurumurthy S, Rangnekar VM. Suppression of PTEN expression by Nf-B prevents apoptosis. Mol Cell Biol. 2004;24(3):1007-1021. doi: 10.1128/Mcb.24.3.1007-1021.2004
  22. Koul D, Takada Y, Shen R, et al. PTEN enhances TNF-induced apoptosis through modulation of nuclear factor-Kappab signaling pathway in human glioma cells. Biochem Biophys Res Commun. 2006;350(2):463-471. doi: 10.1016/J.Bbrc.2006.09.077

Supplementary files

Supplementary Files Action
1. Fig. 1. The relationship between transcriptional and growth factors in papillary thyroid carcinoma. Lines denote direct bonds between molecular markers. View (33KB) Indexing metadata
2. Fig. 2. Scatter plot between PTEN expression and NF-κB p65 expression. View (132KB) Indexing metadata
3. Fig. 3. Scatter plot between PTEN expression and NF-κB p50 expression. View (125KB) Indexing metadata

Views

Abstract - 373

PDF (Russian) - 14

Remote (Russian) - 28

PDF (English) - 11

Remote (English) - 12

Cited-By


PlumX

Dimensions


Copyright (c) 2018 Spirina L.V., Chizhevskaya S.Y., Kondakova I.V.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies